False Positive PDF Free Download

admin 10/13/2021

False-Positive Test Results in Mycobacteriology —A Laboratory Training Program.” The program was designed to help laboratorians recognize and prevent false-positive test results in mycobacteriology. Since 1997, the program has not been updated and similar publications have been limited in recent. Download Pdf False Positive: A Year of Error, Omission, and Political Correctness in the New England Journal of Medicine. A false positive case of high-sensitivity cardiac troponin in a patient with acute chest pain: Analytical study of the interference Circulating cardiac troponin I in acute pericarditis Atrial fibrillation-induced cardiac troponin I release.

Free
Biochimie 93 (2011) 1731e1737
Contents lists available at ScienceDirect
Biochimie journal homepage: www.elsevier.com/locate/biochi
Research paper
Commercial reverse transcriptase as source of false-positive strand-specific RNA detection in human cells Celine Moison a, b, c, Paola B. Arimondo a, b,1, Anne-Laure Guieysse-Peugeot a, b, * a
MNHN CNRS UMR7196 43 rue Cuvier, 75005 Paris, France INSERM U565, 43 rue Cuvier, 75005 Paris, France c UPMC 4 place Jussieu, 75005 Paris, France b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 23 February 2011 Accepted 7 June 2011 Available online 15 June 2011
Recently, an increasing number of studies describe the existence of non-coding RNAs (ncRNAs) involved in gene expression modulation. Since the observation that antisense ncRNAs are implicated in human disorders, there is more and more interest in ncRNAs. A commonly used technique to investigate the expression of an antisense ncRNAs is strand-specific reverse transcription coupled with polymerase chain reaction (RT-PCR). The advantage of this accurate technique is that it does not require any special equipment or expertise. The disadvantage is that it can lead easily to false-positive results. We applied strand-specific RT-PCR to investigate the presence of antisense ncRNA associated to Retinoic Acid Receptor Beta 2 (RARb2) in different human tumoral cell lines. By performing this technique, we observed false-positive detection of ncRNA. For accurate interpretation of the results in RT-PCR experiments, we introduced a «No primer» control that reveals non-specific cDNA synthesis. Moreover, we report the presence of non-specific cDNA amplification with five of the most frequently used reverse transcriptase in absence of added primers. We found that the choice of the reverse transcriptase as well as the conditions of the reaction (RT temperature and PCR cycle number) are important parameters to choose as the different reverse transcriptases do not display the same cDNA synthesis background. This previously observed phenomenon was reported to originate from the «self-priming» of RNA template. Here, we report rather the presence of RNA contaminants associated with one of the reverse transcriptase studied that might contribute to non-specific cDNA synthesis. Ó 2011 Elsevier Masson SAS. All rights reserved.
Keywords: RT-PCR false-positive RT false-priming Strand-specific RNA detection ncRNA
1. Introduction Till recently, the vast majority of the genome of multicellular organisms containing non-protein-coding sequences was considered «junk DNA » and non-coding RNAs (ncRNAs) to be transcriptional noise arising from this «junk DNA ». Today genome-wide studies have pointed out that most of the plants and animals genomes are transcribed [1e5] and there are increasing examples of the functionality of these ncRNAs in normal cell functioning [6] and disorders [7]. Although the current literature is dominated by short ncRNAs, there are quite a number of reports describing long transcripts that, rather than encoding proteins, act as functional RNAs [8]. One of the most documented functional long ncRNA is XIST and its antisense partner TSIX implicated in mammalian
* Corresponding author. INSERM U565, 43 rue Cuvier, 75005 Paris, France. Tel.: þ33 140793684; fax: þ33 140793705. E-mail address: [email protected] (A.-L. Guieysse-Peugeot). 1 Present address: USR 3388 -ETaC- CNRS-Pierre Fabre CRDPF 3 Avenue Hubert Curien 31 035 TOULOUSE Cedex 01, France. 0300-9084/$ e see front matter Ó 2011 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.biochi.2011.06.005
chromosome X inactivation [9]. Among the identified long ncRNAs, endogenous antisense transcripts overlapping at least in part sense transcripts have also been involved in human disorders including cancer [7]. Yu et al. [10] reported the epigenetic silencing of the tumor suppressor gene P15 by its antisense RNA abnormally expressed in leukaemia cells. Perez et al. [11] identified abundantly expressed long ncRNAs frequently deregulated in tumors. In addition, whole-genomic analysis by tiling arrays have enlightened the existence of many long ncRNAs across the entire genome - their functions are still under investigation [12]. Therefore, there is a strong gain of interest in natural long antisense transcripts. Microarray analysis and large-scale sequencing of long ncRNAs provide the advantage of high-throughput data, however, they also require special tools and expertise. Because of their length (from a hundred to several thousand base pairs), the most simple and widespread approach to detect a specific long ncRNA is reverse transcription followed by polymerase chain reaction (RT-PCR). It is generally a readily available technology for laboratories and does not require special equipment and technical knowledge. RT-PCR is a highly sensitive widely used technique. The critical step of the
1732
C. Moison et al. / Biochimie 93 (2011) 1731e1737
procedure is the production of DNA from the RNA template by retroviral reverse transcriptase (RT) in the presence of sequencespecific or random oligodeoxynucleotide primers. To specifically identify antisense ncRNA overlapping sense transcripts but oppositely oriented, it is not possible to use random oligodeoxynucleotide primer RT-PCR since it cannot distinguish between the two species. To avoid this problem, strand-specific primers are used leading to the specific reverse transcription of the sense or the antisense RNA followed then by PCR amplification. For detection of antisense RNA, only the primer complementary to this strand is added in the RT reaction in order to obtain cDNA synthesis only when the antisense transcript is present in the total RNA sample. Here we applied this technique to a chosen target and observed a non-specific amplification and false-positive results. These results were obtained with high reproducibility with five different commercial RTs on three genes in several human cell lines. This non-specific cDNA synthesis leading to strand-specificity aberrant detection was previously observed in the field of Virology where this approach was used to distinguish between negative and positive-strand viral RNA [13e16] and is known as «false-priming». Several mechanisms have been proposed to explain how cDNA synthesis comes from false-priming during the RT reaction, including random priming by contaminating endogenous or exogenous nucleic acids [14,17,18] and RNA secondary hairpin structures that can be recognized and extended by the RT enzymes, the so-called «self-priming» [17,19,20]. Here we demonstrate that such non-specific cDNA synthesis is a global phenomenon occurring also with human cellular RNA. Depending on the RT enzyme used, it leads to different levels of false-positive strand-specific RTPCR results that can be misinterpreted in absence of appropriate controls. This is of fundamental importance in all applications looking for sense and antisense RNA strand-specific detection. In our experiments, we found small RNA contaminants in AMV RT commercial preparations that could be involved in falsely-primed cDNA synthesis.
2.4. cDNA synthesis Each reaction contained 2 mg of total RNA, 0.5 mM of dNTPs (New England Biolabs), either 5 ng/mL of random hexamers (Amersham) or 1 mM of sequence-specific primer and 40 units of RNase inhibitor (Promega) in 20 mL final volume. cDNA synthesis reactions were performed 40 min at 42 0002 C with 200 units of Superscript II RT (Invitrogen), 20 units of AMV RT (Finnzymes), 200 units of M-MuLV RT (New England Biolabs), 200 units of M-MLV RT (Promega) or 200 units of M-MLV RT RNase H Minus. After inactivation of RT enzyme 15 min at 75 0002 C, the RNA template was hydrolyzed with 10 mg of RNase A upon treatment 30 min at 37 0002 C. RT controls were performed by the omission of RNA template, RT enzyme or primers. We replaced supplier’s enzyme buffers by home made buffers according to the available composition. To perform RARb2 strand-specific cDNA synthesis we used S1 primer (50 - TCGATTTAGGGTAAGGCCGTCTGA -30 ) and AS1 primer (50 AGGCGTAAAGGGAGAGAAGTTGGT -30 ). Modifications in this protocol, if any, are specified in figure legends. 2.5. PCR
2. Material and methods
Each sample reaction of PCR amplification was done with 2 mL of the above RT product with Taq DNA Polymerase (New England Biolabs) according to manufacturer’s instructions. Primers used to amplify were the following: RARa 50 -AGGAGTCTGTGAGAAACGACCGAA-30 (forward) and 50 -AGGCCCTCTGAGTTCTCCAACATT30 (reverse); b-actin 50 - GGGTCAGAAGGATTCCTATG -30 (forward) and 50 - GGTCTCAAACATGATCTGGG -30 (reverse); RARb2 50 TTCTGTCAGTGAGTCCTGGGCAAA -30 (forward Frarb) and 50 GAGATCGTCCAACTCAGCTGTCA -30 (reverse Rrarb). PCR amplification produces a 796 bp, 238 bp or 522 bp fragment, respectively. PCR amplification program was: 94 0002 C for 3 min, followed by 28e30 cycles: 94 0002 C for 30 s, 58 0002 C for 30 s, 72 0002 C for 30e60 s and then 10 min at 72 0002 C. Amplicons were analyzed on agarose gel (2%, TBE1X) electrophoresis. M is a 100 bp DNA ladder from New England Biolabs.
2.1. Cells and media
2.6. Radioactive labeling
A549 (lung carcinoma), Hs578T (breast carcinoma), DU145 (prostate carcinoma) and LNCaP (prostate carcinoma) human tumoral cells were obtained from the ATCC (Manassas, VA). A549 and Hs578T cells were grown in Dulbecco’s Modified Eagle Medium (Invitrogen), DU145 and LNCaP cells in RPMI 1640 Medium (Invitrogen). The media were supplemented with 10% fetal bovine serum (Hyclone, Perbio), 10 mM L-glutamine (Invitrogen), and for Hs578T cells also with 0.01 mg/mL insuline (Sigma). The cells were maintained at 37 0002 C and 5% CO2. To perform RNA extractions, cells were grown at 70e80% confluency and harvested.
To detect hypothetical nucleic acid contamination in the commercial RT preparations, we incubated 15 mL of each enzyme preparation after heating it 10 min at 95 0002 C with 10 units of T4 polynucleotide kinase (New England Biolabs) and 10 mCi [g-32P] ATP (Perkin Elmer). As a marker, a 21 oligoribonucleotide long and tRNA (ROCHE) were labeled in the same conditions. After 20 min at 37 0002 C, samples were purified on Micro Bio-SpinÒ 6 chromatography columns (BIO-RAD), treated or not 30 min at 37 0002 C with 5 units of DNase I or 10 mg of RNase A and ethanol precipitated. The samples were analyzed on 12% [19:1] denaturing polyacrylamide gels (7M urea TBE1X).
2.2. RNA extraction
3. Results
Total RNA was extracted using Trizol reagent (Invitrogen) or mini column (Rneasy Mini Kit, Qiagen) according to manufacturer’s protocols.
3.1. False-positive detection of ncRNA
2.3. RNA treatment RNA sample were submitted to different treatments: 30 min at 37 0002 C with 5 units of DNase I (New England Biolabs), 30 min at 37 0002 C with 5 units of RNase H (New England Biolabs) following the manufacturer’s protocols or heated 8 min at 95 0002 C. RNA integrity was systematically checked on 1% agarose gel TBE1X.
Strand-specific RT-PCR is currently used to investigate the expression of antisense ncRNA. We applied it to Retinoic Acid Receptor Beta 2 (RARb2), using Superscript II reverse transcriptase (Invitrogen). We used a sense-specific primer S1 and an antisensespecific primer AS1, designed to reverse-transcribe the known RARb2 mRNA and an hypothetical RARb2 antisense ncRNA, respectively (Fig. 1A). In order to validate the strategy, we then performed amplification with primers (FrarbeRrarb) to detect the known RARb2 spliced mRNA specifically reverse-transcribed by the
C. Moison et al. / Biochimie 93 (2011) 1731e1737
1733
A
B
Fig. 1. RARb2 strand-specific RT-PCR. (A) Schematic representation of the primers used for the detection of RARb2 RNAs by RT-PCR. Arrows on the RARb2 gene and mRNA indicate the localization of the primers: sense-specific S1 and antisense-specific AS1 primers were used to reverse-transcribe the sense RARb2 mRNA and a potential antisense ncRNA, respectively. The PCR was performed with primers Frarb and Rrarb to produce a 522 bp fragment overlapping four exons of RARb2 mRNA. P: promoter, Ex: exon, mRNA: messenger RNA. (B) Background cDNA synthesis can lead to false-positive results. 2 mg total RNA of A549 cells were reverse-transcribed by Superscript II with random primers RP (lanes 1, 4 and 7), S1 sense-specific primer (lane 2), AS1 antisense-specific primer (lane 3), without primer (lanes 5 and 6), without reverse transcriptase (lane 4) or without RNA template (lane 7). Sample in lane 6 was heated 8 min at 95 0002 C before cDNA synthesis. Then PCR (30 cycles) was performed with Frarb and Rrarb primers to amplify a 522 bp fragment. Lane 8 is a PCR control where cDNA is replaced by H2O. M is a 100 bp ladder marker.
sense S1 strand-specific primer but not by the antisense AS1 strand-specific primer. RNA was extracted from tumoral cell lines, checked for its purity, quantified and then reverse-transcribed in cDNA under different conditions followed by a PCR amplification and analysis on agarose gel. As expected, in A549 lung cancer cells known to express RARb2 mRNA, cDNA synthesis upon use of the sense S1 strand-specific primer allowed to detect a PCR product corresponding to RARb2 mRNA (Fig. 1B, lane 2), which is also detected with random primers (lane 1). Surprisingly, the antisense AS1 strand-specific primer gave the same size product PCR (lane 3). As it is very unlikely to have a long antisense RNA as spliced as the corresponding mRNA, the PCR product was sequenced and it corresponded indeed to the RARb2 mRNA. The same results were obtained in Hs578T breast cancer cells and using different RARb2 couple of primers (data not shown). In view of these results, we decided to work on the RT-PCR controls. Generally, the most common RT-PCR negative control is reverse transcription in the absence of the RT enzyme, the so-called «No RT» (lane 4) that enables to reveal possible DNA contamination in the experiment. We performed two additional controls. First, cDNA synthesis was carried out in the absence of RNA template («No RNA», lane 7). Second, no primers were added during the RT step («No primer», lane 5). While the negative controls «No RT» and «No RNA» gave as expected no PCR amplification signal, the RT in the absence of exogenous primers («No primer») resulted in a product of the same size and intensity as with the antisense AS1 strand-specific primer. These observations strongly suggested that the PCR product detected with AS1 strand-specific primer did not result from the presence of an antisense ncRNA but rather from the non-specific reverse transcription of the spliced RARb2 mRNA present in total RNA sample. To test this hypothesis we performed the same experiment on two human prostate tumor cell lines (DU145 and LNCaP) that do not express RARb2 mRNA and, as expected, no amplification was detected (data not shown). Thus in the absence of
primers or in the presence of an antisense strand-specific primer we detected a false-positive PCR product corresponding to the sense mRNA. Importantly, ncRNAs are potentially low expressed transcripts and their specific signal can be very close to the background level due here to non-specific cDNA synthesis. It was critical to understand if this non-specific cDNA synthesis is specific to RARb2 or is a more global phenomenon and where does it come from. 3.2. Non-specific cDNA synthesis is a global event independent of exogenous primer We then performed RT-PCR experiments on Retinoic Acid Receptor a (RARa) in A549 human tumoral cells using Superscript II reverse transcriptase (Fig. 2A). As expected, RARa mRNA was highly detectable in A549 cells (lane 1). In agreement with the results obtained for RARb2, no product amplification was detected in «No RT» (lane 3) and «No RNA» (lane 4) controls, while a significant amplification was observed in the «No primer» (lane 2) control. These observations were reproduced up to five times for different mRNAs including the widely used control b-actin mRNA (Fig. 2B). The PCR products obtained in «No primer» samples were sequenced and corresponded to the RARa and b-actin mRNAs, respectively. Importantly, only for b-actin, the «No primer» control (lane 2) showed a particular high level of non-specific amplification, close to one of the specific signal observed in presence of random primers (lane 1). This may be related to the fact that b-actin mRNA is abundant in RNA samples and thus is more subjected to non-specific cDNA synthesis than less expressed genes. These results suggest that non-specific cDNA synthesis is a general event that does not need addition of external primers and is geneindependent. We then addressed where the in vitro non-specific cDNA synthesis comes from.
1734
C. Moison et al. / Biochimie 93 (2011) 1731e1737
A
B
described to eliminate small RNAs. This RNA purification method did not eliminate non-specific RT background suggesting that small cellular RNAs are not involved in non-specific cDNA synthesis (data not shown). We then addressed the question whether DNA contaminants are present in the RNA extracts that would act as primers for the Superscript II enzyme. RNA samples were treated with DNase I that hydrolyzes DNA duplexes, or RNase H, an endoribonuclease that specifically hydrolyzes the phosphodiester bonds of RNA hybridized to DNA in order to eliminate potential RNA-DNA duplexes. Despite these treatments, the background amplification in the «No primer» control was still present (Fig. 2AeB, lanes 6 and 7) suggesting that DNA contamination was not at the origin of the priming in the RT step. As non-specific cDNA synthesis occurred on mRNA template (data not shown) as well as on total RNA, it could have possibly originated from the self-priming of mRNA themselves. Publications describing primer-independant cDNA synthesis in virus RNA [13e16] hypothesized that formation of secondary structured RNA promote their own reverse transcription by providing free 30 OH extremity to RT enzyme. This mechanism called «self-priming» implicates the formation of enough stable RNA duplexes to serve as substrate for reverse transcriptase. We tested this hypothesis with different available commercial enzymes. 3.4. Reverse transcriptases display unequal non-specific cDNA synthesis
Fig. 2. Exogenous primer-independent cDNA synthesis. (A)-(B) Global cDNA synthesis in the absence of external primers. (A) 2 mg of total RNA of A549 tumoral cells were reverse-transcribed by Superscript II with (lanes 1, 3, 4 and 5) or without (lanes 2, 6 and 7) addition of random primers RP, without Superscript II reverse transcriptase (lane 3) or without RNA template (lane 4). Before cDNA synthesis, samples were treated with RNase H (lanes 5 and 6) or DNase I (lane 7). After the RT step, PCR (30 cycles) was performed using primers specific for RARa mRNA amplifying a 796 bp fragment (that was confirmed by sequencing). Lane 8 is a PCR control where cDNA is replaced by H2O. M is a 100 bp ladder marker. (B) Samples were reverse-transcribed as in (A) and PCR (28 cycles) was performed using b-actin specific primers amplifying a 238 bp fragment.
3.3. What can explain primer-independent cDNA synthesis? As reverse transcriptase needs nucleic acid 30 OH extremity to prime cDNA synthesis, the background observed may be due to either the presence of contaminating nucleic acid acting as nonspecific primers for the Superscript II reverse transcriptase in the RT reaction, or secondary structured RNAs allowing their own priming. First, we excluded primer contaminations coming from our laboratory by systematic reproducibility of these results using different RNA samples, batch of commercial enzymes, buffers, experimenters and laboratory spaces. We then focused to search an endogenous origin of non-specific cDNA synthesis. Since a recent publication [21] described that endogenous miRNAs could act as primers for RT enzymes, we tested whether our cellular RNA samples contained small nucleic acid species serving as primers for the RT reaction. We heated for 8 min at 95 0002 C the RNA samples prior to cDNA synthesis in order to denaturate potential miRNA-mRNA duplexes and hence eliminate priming, as described by Khraiwesh et al. [21]. Heating had no effect on the RTPCR non-specific amplification of the RARb2 mRNA (Fig. 1B, lane 6). In order to further investigate the possibility of small RNAs acting as primers, we used, instead of Trizol, RNA extraction mini column (QIAGEN) to extract RNA from cells since these columns are
We tested four other RT enzymes commercially available: AMV RT (Finnzymes), M-MuLV RT (New England Biolabs), M-MLV RT and M-MLV RT RNase H Minus (Promega). We systematically observed the presence of non-specific cDNA synthesis in absence of added primers (Fig. 3, lanes 2). Surprisingly, background cDNA synthesis levels were different with the five commercial RTs (Fig. 3, to compare lanes 2). One can imagine that self-priming should generate equal non-specific cDNA synthesis, whatever the enzyme used. So, unless they have different capacity to initiate cDNA synthesis from the 30 OH extremity of secondary structured RNA, it seems possible that the differences observed depend on the reverse transcriptase themselves rather than on the template. In addition, we compared non-specific cDNA synthesis after reverse transcription performed at 42 0002 C, 50 0002 C or 56 0002 C using two thermostable RT enzymes (Superscript II Fig. 4A and AMV RT Fig. 4B), as self-priming was previously shown to be reduced upon increasing RT reaction temperature to limit RNA folding [22,23]. Increasing the temperature did decrease the amplification signal in «No primer» with both enzymes (lanes 5 and 8) but the global efficiency of the RT was affected (lanes 4 and 7). 3.5. Identification of small RNA tightly associated with AMV RT Agranovsky et al. [24] reported back in 1992 significant background cDNA synthesis in plant virion RNAs without adding exogenous primers. The authors hypothesized that their commercial AMV RT enzyme preparation was contaminated by transfer RNAs (tRNAs) serving as primers for cDNA synthesis. This is consistent with the fact that in vivo conversion of natural retroelements into DNA is primed by specific tRNAs through sequence complementary [25]. To test this hypothesis, we first checked if commercial buffers provided with enzymes were contaminated by primers replacing them by home made solutions according to the manufacturer’s protocol. Results were unchanged. Then, we denaturated by heating the five different RT preparations and incubated them with [g-32P] ATP and T4 polynucleotide kinase to label potential nucleic acid contaminants (Fig. 5 and data not shown). We detected the
C. Moison et al. / Biochimie 93 (2011) 1731e1737
1735
Fig. 3. Five different commercial reverse transcriptases displayed unequal non-specific cDNA synthesis. cDNA synthesis was performed on 2 mg of A549 cells total RNA with (lane 1) or without (lane 2) addition of random primers RP and without RT enzyme (lane 3). Experiments were carried out in (A) using Superscript II RT (RNase H 0003), AMV RT (RNase H þ), MMuLV RT (RNase H þ), and in (B) using M-MLV RT (RNase H þ) or M-MLV RT RNase H Minus commercial preparations with home made buffers. The PCR (30 cycles) was performed with primers specific for RARa mRNA amplifying a 796 bp fragment. Lane 4 is a PCR control where cDNA is replaced by H2O. M is a 100 bp ladder marker.
presence of small oligonucleotides (a 21 nt is used as marker) in AMV reverse transcriptase preparation (lane 4) that are degraded after RNase A (lane 6) but not DNase I (lane 5) treatment. Importantly, radiolabeling of the contaminants of AMV RT is inefficient without prior denaturation (10 min at 90 0002 C) (data not shown). We then attempted to eliminate these short RNA contaminants detected in all tested AMV RT preparations. Size exclusion membrane (Amicon ultra e 0,5 Centrifugal Filter Devices - 10K Membrane), known to capture short RNAs (under 30 nucleotides-long) but not the large molecular weight RT protein, were inefficient as treatment of the AMV RT preparations with RNase A without prior denaturation by heat (Supplementary Fig. 1). Taken together, these observations strongly suggest a tight interaction between the enzyme and RNA contaminants that can be heat-reversed. We propose that short RNA molecules associated to RT enzyme may be involved in falsely-primed cDNA synthesis. According to this, we used AMV-labeled contaminants as primers in an RT reaction and showed that they can prime cDNA synthesis as oligo(dT) or random primers (Supplementary Fig. 2). With the four other enzymes, no distinct labeled nucleic acids were observed but rather a smear (data not shown). This can be explained by the presence of several size contaminants and/or by an inefficient radiolabeling at the 50 end. 4. Discussion During our investigation on the existence of RARb2 antisense ncRNAs, we came across an unexpectedly high level of false-positive results. cDNA synthesis from cellular total RNA without adding primers revealed a global non-specific reverse transcription of the RNA template. This false-primed event has been well documented in the field of Virology, in which it is a high source of false-positive
results during strand-specific viral RNA detection [13e16]. It is believed that the origin of primer-independent cDNA synthesis comes from either the presence of cellular nucleic acids contaminants like oligo(dT) [18], exogenous nucleic acid contaminants [14,17] or secondary structured RNAs [17,19,20]. We demonstrated that initiation of the reverse transcription occurring in the absence of exogenous primers is a global phenomenon present also with human cellular RNAs. Gunji et al. hypothesized in 1994 [14] that hepatitis C virus RNA promotes its reverse transcription by 30 -end RNA looping involving the formation of RNAeRNA duplexes that could serve as primers for the polymerase. Similarly, self-priming of human cellular RNAs could eventually explain the non-specific cDNA synthesis observed in this report. Noteworthy, we showed that five of the most commonly used RT enzymes display non-specific cDNA synthesis, but the amount of background was not the same depending on the RT enzyme (Fig. 3). Therefore, this observation raised the possibility that non-specific cDNA synthesis came from the enzyme themselves rather than from the RNA template. We showed that reverse transcriptase RNase H activity was not implicated since cDNA synthesis was observed independently of an associated RNase H activity (Fig. 3). In 1992, exogenous primer-independent cDNA synthesis on plant virus RNAs was also reported with AMV reverse transcriptase preparations but not with M-MLV ones [24]. Since in vivo viral reverse transcriptases use tRNAs as primers [25], the authors proposed that contaminating tRNAs found in commercial preparations of AMV RT but not M-MLV RT were responsible for this nonspecific cDNA synthesis. Here, we found RNA contaminants of about 20 nt long in AMV RT commercial preparations smaller than 60e90 nt tRNAs (Fig. 5). Column filtering and RNase A treatment of the native AMV RT enzyme did not remove the small RNAs. These
Fig. 4. Temperature effect on background cDNA synthesis. (A)e(B) Increased RT reaction temperature is not sufficient to eliminate non-specific cDNA synthesis. (A) 2 mg total RNA of A549 tumoral cells were reverse-transcribed at 42 0002 C, 50 0002 C or 56 0002 C by Superscript II with (lanes 1, 3, 4, 6, 7 and 9) or without (lanes 2, 5 and 8) addition of random primers RP, and without Superscript II reverse transcriptase (lanes 3, 6 and 9). After the RT step, PCR (30 cycles) was performed using primers specific for RARa mRNA amplifying a 796 bp fragment. Lane 10 is a PCR control where cDNA is replaced by H2O. M is a 100 bp ladder marker. (B) Samples were reverse-transcribed with AMV reverse transcriptase and amplified in the same conditions as described in (A).
1736
C. Moison et al. / Biochimie 93 (2011) 1731e1737
As a relevant example, Rosok and Sioud [26] described, by strandspecific RT-PCR in the breast cancer cell line SKBR3 that «a substantial number of antisense transcripts were found to be complementary to the spliced mRNAs over several exons, suggesting the presence of RNA-dependent RNA polymerase activity in human cells». Our data do not exclude that these observations may come from the non-specific cDNA synthesis of the corresponding sense mRNA present in total RNA template rather than in vivo expressed antisense ncRNAs, since the size of the amplified product corresponds to one of the sense mRNA. A «No primer» control could answer this point. Notably, we observed here that the level of non-specific cDNA synthesis is very different with the five reverse transcriptase enzymes. Superscript II reverse transcriptase from Invitrogen gave the weakest signal. The choices of RT enzyme, conditions of the RT reaction (temperature and time) as well as PCR reaction (cycle number) are important parameters to take into account to minimize background cDNA synthesis. In order to prevent the amplification of false-primed cDNAs generated during reverse transcription, Lanford et al. [13] developed a tagged RT-PCR. This method relies on the use of a strandspecific RT primer modified by adding a 19-mer-long «tag» sequence at its 50 -end. The tagged-cDNAs generated are then amplified by PCR using the 19-mer-long tag oligonucleotide as one of the primers and a reverse target-specific primer. This strategy has been successfully applied to the strand-specific detection of several viral RNAs [16,27,28]. Finally, it is useful to confirm the results with complementary techniques like in situ hybridization or Northern blotting using strand-specific probes. 5. Conclusions
Fig. 5. Detection of small RNA species in AMV RT commercial preparations. 21 ribonucleotide long (lanes 1, 2 and 3), AMV RT preparation (lanes 4, 5 and 6) and tRNA (lanes 7, 8 and 9) were denaturated 10 min at 90 0002 C before incubated with [g-32P] ATP and T4 polynucleotide kinase. After labeling, samples were treated with DNase I (lanes 2, 5 and 8), RNase A (lanes 3, 6 and 9) or not treated (lanes 1, 4 and 7) and then electrophoresed on a denaturant 12% [19:1] polyacrylamide gel 7M urea TBE1X. As a control, only [g-32P] ATP and T4 polynucleotide kinase were incubated together as described (noted H2O on the gel).
observations strongly suggest the presence of tight interactions between them and AMV RT. This may also explain why radiolabeling without prior heat-denaturation of AMV RT preparation was inefficient. The presence of small RNA contaminants strongly associated with AMV reverse transcriptase could thus be involved in non-specific cDNA priming. Noteworthy, no distinct nucleic acid contaminants were identified in other RT preparations but only smears, maybe because of strong interactions between the enzyme and small RNAs leading to 50 end inaccessibility for radioactive labeling. Importantly, these false-positive results are a general event: they were obtained in the literature with viral RNA and here we observed them in total RNA extracted from four different human tumoral cell lines (A549, Hs578T, DU145 and LNCaP) and for various mRNAs (RARb2, RARa and b-actin). In most RT-PCR applications, it is not worth considering this background cDNA synthesis whereas in the case of antisense ncRNA specific detection this may induce to false-positives results. During the reverse transcription of an antisense ncRNA by strand-specific primer, the corresponding sense transcript will also be reverse-transcribed in a non-specific and uncontrolled way. The following PCR amplification can then arise from the reverse transcription of both the sense and antisense RNA.
As extensively described in virus, we showed that initiation of cDNA synthesis during RT-PCR can occur on human cellular mRNA without addition of any exogenous primers in the RT step. This nonspecific cDNA synthesis is a global phenomenon, detected at different level with five of the most used commercial reverse transcriptases. This can interfere with RT specificity and is a high source of false-positive results, especially in the discrimination of antisense from sense RNA. When performing strand-specific RTPCR, we strongly recommend to perform a «No primer» control as it allows to correctly determine the background cDNA synthesis level and distinguish between accurate and false-positive results. Importantly, it is not easy to reverse-transcribe selectively a chosen target among total RNA sample, and this should be considered when conducting gene-specific or strand-specific experiments. Finally, RNA secondary hairpin structures are described in the literature to cause non-specific reverse transcription. Here, we observed the presence of small RNA tightly associated with RT enzyme that could be an other mechanism contributing falsepriming of cDNA synthesis. Acknowledgements This work was supported by ANR-06 JCJCJ-0080-01 to PBA and by the French Ministry of Research to CM. The authors thank the three referees for their constructive remarks, and the DNA methylation team for helpful discussions. A special thanks to Loïc Ponger for instructive comments. Appendix. Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.biochi.2011.06.005.
C. Moison et al. / Biochimie 93 (2011) 1731e1737
References [1] Y. Okazaki, M. Furuno, T. Kasukawa, J. Adachi, H. Bono, S. Kondo, I. Nikaido, N. Osato, R. Saito, H. Suzuki, I. Yamanaka, H. Kiyosawa, K. Yagi, Y. Tomaru, Y. Hasegawa, A. Nogami, C. Schonbach, T. Gojobori, R. Baldarelli, D.P. Hill, C. Bult, D.A. Hume, J. Quackenbush, L.M. Schriml, A. Kanapin, H. Matsuda, S. Batalov, K.W. Beisel, J.A. Blake, D. Bradt, V. Brusic, C. Chothia, L.E. Corbani, S. Cousins, E. Dalla, T.A. Dragani, C.F. Fletcher, A. Forrest, K.S. Frazer, T. Gaasterland, M. Gariboldi, C. Gissi, A. Godzik, J. Gough, S. Grimmond, S. Gustincich, N. Hirokawa, I.J. Jackson, E.D. Jarvis, A. Kanai, H. Kawaji, Y. Kawasawa, R.M. Kedzierski, B.L. King, A. Konagaya, I.V. Kurochkin, Y. Lee, B. Lenhard, P.A. Lyons, D.R. Maglott, L. Maltais, L. Marchionni, L. McKenzie, H. Miki, T. Nagashima, K. Numata, T. Okido, W.J. Pavan, G. Pertea, G. Pesole, N. Petrovsky, R. Pillai, J.U. Pontius, D. Qi, S. Ramachandran, T. Ravasi, J.C. Reed, D.J. Reed, J. Reid, B.Z. Ring, M. Ringwald, A. Sandelin, C. Schneider, C.A. Semple, M. Setou, K. Shimada, R. Sultana, Y. Takenaka, M.S. Taylor, R.D. Teasdale, M. Tomita, R. Verardo, L. Wagner, C. Wahlestedt, Y. Wang, Y. Watanabe, C. Wells, L.G. Wilming, A. Wynshaw-Boris, M. Yanagisawa, I. Yang, L. Yang, Z. Yuan, M. Zavolan, Y. Zhu, A. Zimmer, P. Carninci, N. Hayatsu, T. HirozaneKishikawa, H. Konno, M. Nakamura, N. Sakazume, K. Sato, T. Shiraki, K. Waki, J. Kawai, K. Aizawa, T. Arakawa, S. Fukuda, A. Hara, W. Hashizume, K. Imotani, Y. Ishii, M. Itoh, I. Kagawa, A. Miyazaki, K. Sakai, D. Sasaki, K. Shibata, A. Shinagawa, A. Yasunishi, M. Yoshino, R. Waterston, E.S. Lander, J. Rogers, E. Birney, Y. Hayashizaki, Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs, Nature 420 (2002) 563e573. [2] S. Katayama, Y. Tomaru, T. Kasukawa, K. Waki, M. Nakanishi, M. Nakamura, H. Nishida, C.C. Yap, M. Suzuki, J. Kawai, H. Suzuki, P. Carninci, Y. Hayashizaki, C. Wells, M. Frith, T. Ravasi, K.C. Pang, J. Hallinan, J. Mattick, D.A. Hume, L. Lipovich, S. Batalov, P.G. Engstrom, Y. Mizuno, M.A. Faghihi, A. Sandelin, A.M. Chalk, S. Mottagui-Tabar, Z. Liang, B. Lenhard, C. Wahlestedt, Antisense transcription in the mammalian transcriptome, Science 309 (2005) 1564e1566. [3] J.M. Johnson, S. Edwards, D. Shoemaker, E.E. Schadt, Dark matter in the genome: evidence of widespread transcription detected by microarray tiling experiments, Trends Genet. 21 (2005) 93e102. [4] P. Bertone, V. Stolc, T.E. Royce, J.S. Rozowsky, A.E. Urban, X. Zhu, J.L. Rinn, W. Tongprasit, M. Samanta, S. Weissman, M. Gerstein, M. Snyder, Global identification of human transcribed sequences with genome tiling arrays, Science 306 (2004) 2242e2246. [5] P. Carninci, T. Kasukawa, S. Katayama, J. Gough, M.C. Frith, N. Maeda, R. Oyama, T. Ravasi, B. Lenhard, C. Wells, R. Kodzius, K. Shimokawa, V.B. Bajic, S.E. Brenner, S. Batalov, A.R. Forrest, M. Zavolan, M.J. Davis, L.G. Wilming, V. Aidinis, J.E. Allen, A. Ambesi-Impiombato, R. Apweiler, R.N. Aturaliya, T.L. Bailey, M. Bansal, L. Baxter, K.W. Beisel, T. Bersano, H. Bono, A.M. Chalk, K.P. Chiu, V. Choudhary, A. Christoffels, D.R. Clutterbuck, M.L. Crowe, E. Dalla, B.P. Dalrymple, B. de Bono, G. Della Gatta, D. di Bernardo, T. Down, P. Engstrom, M. Fagiolini, G. Faulkner, C.F. Fletcher, T. Fukushima, M. Furuno, S. Futaki, M. Gariboldi, P. Georgii-Hemming, T.R. Gingeras, T. Gojobori, R.E. Green, S. Gustincich, M. Harbers, Y. Hayashi, T.K. Hensch, N. Hirokawa, D. Hill, L. Huminiecki, M. Iacono, K. Ikeo, A. Iwama, T. Ishikawa, M. Jakt, A. Kanapin, M. Katoh, Y. Kawasawa, J. Kelso, H. Kitamura, H. Kitano, G. Kollias, S.P. Krishnan, A. Kruger, S.K. Kummerfeld, I.V. Kurochkin, L.F. Lareau, D. Lazarevic, L. Lipovich, J. Liu, S. Liuni, S. McWilliam, M. Madan Babu, M. Madera, L. Marchionni, H. Matsuda, S. Matsuzawa, H. Miki, F. Mignone, S. Miyake, K. Morris, S. Mottagui-Tabar, N. Mulder, N. Nakano, H. Nakauchi, P. Ng, R. Nilsson, S. Nishiguchi, S. Nishikawa, F. Nori, O. Ohara, Y. Okazaki, V. Orlando, K.C. Pang, W.J. Pavan, G. Pavesi, G. Pesole, N. Petrovsky, S. Piazza, J. Reed, J.F. Reid, B.Z. Ring, M. Ringwald, B. Rost, Y. Ruan, S.L. Salzberg, A. Sandelin, C. Schneider, C. Schonbach, K. Sekiguchi, C.A. Semple, S. Seno, L. Sessa, Y. Sheng, Y. Shibata, H. Shimada, K. Shimada, D. Silva, B. Sinclair, S. Sperling, E. Stupka, K. Sugiura, R. Sultana, Y. Takenaka, K. Taki, K. Tammoja, S.L. Tan, S. Tang, M.S. Taylor, J. Tegner, S.A. Teichmann, H.R. Ueda, E. van Nimwegen, R. Verardo, C.L. Wei, K. Yagi, H. Yamanishi, E. Zabarovsky, S. Zhu, A. Zimmer, W. Hide, C. Bult, S.M. Grimmond, R.D. Teasdale, E.T. Liu, V. Brusic, J. Quackenbush, C. Wahlestedt, J.S. Mattick, D.A. Hume, C. Kai, D. Sasaki, Y. Tomaru, S. Fukuda, M. Kanamori-Katayama, M. Suzuki, J. Aoki, T. Arakawa, J. Iida, K. Imamura, M. Itoh, T. Kato, H. Kawaji, N. Kawagashira, T. Kawashima, M. Kojima, S. Kondo, H. Konno, K. Nakano, N. Ninomiya, T. Nishio, M. Okada,
[6] [7] [8] [9]
[10]
[11]
[12] [13]
[14]
[15]
[16]
[17] [18]
[19]
[20]
[21]
[22]
[23]
[24]
[25] [26] [27]
[28]
1737
C. Plessy, K. Shibata, T. Shiraki, S. Suzuki, M. Tagami, K. Waki, A. Watahiki, Y. Okamura-Oho, H. Suzuki, J. Kawai, Y. Hayashizaki, The transcriptional landscape of the mammalian genome, Science 309 (2005) 1559e1563. P.P. Amaral, J.S. Mattick, Noncoding RNA in development, Mamm. Genome 19 (2008) 454e492. M.A. Faghihi, C. Wahlestedt, Regulatory roles of natural antisense transcripts, Nat. Rev. Mol. Cell Biol. 10 (2009) 637e643. T.R. Mercer, M.E. Dinger, J.S. Mattick, Long non-coding RNAs: insights into functions, Nat. Rev. Genet. 10 (2009) 155e159. T.B. Nesterova, J.E. Mermoud, K. Hilton, J. Pehrson, M.A. Surani, A. McLaren, N. Brockdorff, Xist expression and macroH2A1.2 localisation in mouse primordial and pluripotent embryonic germ cells, Differentiation 69 (2002) 216e225. W. Yu, D. Gius, P. Onyango, K. Muldoon-Jacobs, J. Karp, A.P. Feinberg, H. Cui, Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA, Nature 451 (2008) 202e206. D.S. Perez, T.R. Hoage, J.R. Pritchett, A.L. Ducharme-Smith, M.L. Halling, S.C. Ganapathiraju, P.S. Streng, D.I. Smith, Long, abundantly expressed non-coding transcripts are altered in cancer, Hum. Mol. Genet. 17 (2008) 642e655. J.S. Mattick, The genetic signatures of noncoding RNAs, PLoS Genet. 5 (2009) e1000459. R.E. Lanford, C. Sureau, J.R. Jacob, R. White, T.R. Fuerst, Demonstration of in vitro infection of chimpanzee hepatocytes with hepatitis C virus using strand-specific RT/PCR, Virology 202 (1994) 606e614. T. Gunji, N. Kato, M. Hijikata, K. Hayashi, S. Saitoh, K. Shimotohno, Specific detection of positive and negative stranded hepatitis C viral RNA using chemical RNA modification, Arch. Virol. 134 (1994) 293e302. B. Schoenike, A.K. Franta, J.O. Fleming, Quantitative sense-specific determination of murine corona virus RNA by reverse transcription polymerase chain reaction, J. Virol. Methods 78 (1999) 35e49. C.N. Peyrefitte, B. Pastorino, M. Bessaud, H.J. Tolou, P. Couissinier-Paris, Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR, J. Virol. Methods 113 (2003) 19e28. A.V. Timofeeva, N.A. Skrypina, Background activity of reverse transcriptases, Biotechniques 30 (2001) 22e24 26, 28. C. Piche, J.P. Schernthaner, Background priming during reverse transcription by oligo(dT) carried over from mRNA isolation, Biotechniques 34 (2003) 720e722 724. H. Lerat, F. Berby, M.A. Trabaud, O. Vidalin, M. Major, C. Trepo, G. Inchauspe, Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells, J. Clin. Invest. 97 (1996) 845e851. A. Tuiskunen, I. Leparc-Goffart, L. Boubis, V. Monteil, J. Klingstrom, H.J. Tolou, A. Lundkvist, S. Plumet, Self-priming of reverse transcriptase impairs strandspecific detection of dengue virus RNA, J. Gen. Virol. 91 (2010) 1019e1027. B. Khraiwesh, M.A. Arif, G.I. Seumel, S. Ossowski, D. Weigel, R. Reski, W. Frank, Transcriptional control of gene expression by microRNAs, Cell 140 (2010) 111e122. T. Beiter, E. Reich, C. Weigert, A.M. Niess, P. Simon, Sense or antisense? False priming reverse transcription controls are required for determining sequence orientation by reverse transcription-PCR, Anal. Biochem. 369 (2007) 258e261. F. Haddad, A.X. Qin, J.M. Giger, H. Guo, K.M. Baldwin, Potential pitfalls in the accuracy of analysis of natural sense-antisense RNA pairs by reverse transcription-PCR, BMC Biotechnol. 7 (2007) 21. A.A. Agranovsky, Exogenous primer-independent cDNA synthesis with commercial reverse transcriptase preparations on plant virus RNA templates, Anal. Biochem. 203 (1992) 163e165. R. Marquet, C. Isel, C. Ehresmann, B. Ehresmann, tRNAs as primer of reverse transcriptases, Biochimie 77 (1995) 113e124. O. Rosok, M. Sioud, Systematic identification of sense-antisense transcripts in mammalian cells, Nat. Biotechnol. 22 (2004) 104e108. M. Bessaud, A. Autret, S. Jegouic, J. Balanant, M.L. Joffret, F. Delpeyroux, Development of a Taqman RT-PCR assay for the detection and quantification of negatively stranded RNA of human enteroviruses: evidence for falsepriming and improvement by tagged RT-PCR, J. Virol. Methods 153 (2008) 182e189. N.E. Plaskon, Z.N. Adelman, K.M. Myles, Accurate strand-specific quantification of viral RNA, PLoS One 4 (2009) e7468.

AntiVirus and AntiSpyware False Positives

Some false positive reports occasionally pop up in different antivirus products in conjunction with software. This is partially due to the compression and portablization techniques used but mostly due to a failure of some antivirus companies to properly test virus definition updates or using questionable heuristics detection method. If you encounter a false positive, please test the file in another antivirus product before reporting the issue to us in the forums to ensure that it's not an error in their software. Several companies make available online scanners for individual files, so you won't even have to install software (VirusTotal, MetaDefender, Jotti). Note that these online scanners use dozens of antivirus engines and will generally show false positives in a few of them. In particular, Antiy, Bkav, Jiangmin, Qihoo, and Trapmine seem to have frequent issues with false positives and can usually be ignored. You can also use ClamWin Portable or Emsisoft Portable to scan on the go. Thanks for your help.

PositiveFree

False Positive Pdf free. download full

Support

False Positive Pdf Free Download Free

For help getting an app up and running, visit Portable App Support.